1. Home >
  2. Functional Category Of Talc

Functional Category Of Talc

To detect the presence of talC sequences in Xoo, a pair of primers forward TCTGCGTGCAGCCGATGACCC and reverse CCACCAGTGCCTCGTGGTGCTG was designed to anneal on sites flanking the deleted region Supplementary Figure S2 and amplified a 152 bp fragment from talC and a 224 bp from typical tal sequences. PCR used the GoTaq DNA Polymerase.

Get Price

Products Center

Contact Us

[email protected]

Zhengzhou high tech Industrial Development Zone

Get Latest Price
Get in Touch

Note: If you're interested in the product, please submit your requirements and contacts and then we will contact you in two days. We promise that all your informations won't be leaked to anyone.

Products Center

Products Center